These collections primarily describe transcription-factor–DNA binding. They include source-reported controls and constructs; file totals are not target or validated aptamer totals.
ERR8972371
RV26_s
- Reads
- 4,934,142
- Distinct strings in file
- 4,895,970
- File size
- 25.0 MiB
Source attribution · SHA-256
- Source project:
- PRJEB51212
- Archive record:
- ERR8972371
- Sample:
- SAMEA13183954
- SHA-256
- b32d53f16aa2ee6fda924f5dce4956ae0b9a37feddd8290562e4332370d77092
Exact read query
Queries are case-sensitive. No trimming or reverse-complement merging is applied.
| Sequence | Count | Read fraction |
|---|---|---|
| AAAAAAATATTTTTGTGCTTA | 1 | 2.02669e-07 |
| AAAAAAATATTTTTTATTAAA | 1 | 2.02669e-07 |
| AAAAAAATATTTTTTTTCATT | 1 | 2.02669e-07 |
| AAAAAAATCAAAAAATGAATG | 1 | 2.02669e-07 |
| AAAAAAATCAAAAATAATAAA | 1 | 2.02669e-07 |
| AAAAAAATCAAAAATTAATCG | 1 | 2.02669e-07 |
| AAAAAAATCAAAAATTGAAAA | 1 | 2.02669e-07 |
| AAAAAAATCAAAACTTAAATA | 1 | 2.02669e-07 |
| AAAAAAATCAAAATATAGCTA | 1 | 2.02669e-07 |
| AAAAAAATCAAAATATATTTA | 1 | 2.02669e-07 |
| AAAAAAATCAAAATTTCAATA | 1 | 2.02669e-07 |
| AAAAAAATCAAACCCTAAATA | 1 | 2.02669e-07 |
| AAAAAAATCAAATAAAGATAA | 1 | 2.02669e-07 |
| AAAAAAATCAAATATCATTAG | 1 | 2.02669e-07 |
| AAAAAAATCAAATATCATTAT | 1 | 2.02669e-07 |
| AAAAAAATCAAATATTATTTG | 1 | 2.02669e-07 |
| AAAAAAATCAAATTATATAAG | 1 | 2.02669e-07 |
| AAAAAAATCAAATTCTACTTA | 1 | 2.02669e-07 |
| AAAAAAATCAAATTCTATACA | 1 | 2.02669e-07 |
| AAAAAAATCAAATTTTCTGAA | 1 | 2.02669e-07 |
| AAAAAAATCAACATTATTAAA | 1 | 2.02669e-07 |
| AAAAAAATCAACTAATAATGA | 1 | 2.02669e-07 |
| AAAAAAATCAATAAATAACGA | 1 | 2.02669e-07 |
| AAAAAAATCAATAAATGACAA | 1 | 2.02669e-07 |
| AAAAAAATCAATAACGTCATG | 1 | 2.02669e-07 |
Read fractions use all reads in this source file as the denominator.