These collections primarily describe transcription-factor–DNA binding. They include source-reported controls and constructs; file totals are not target or validated aptamer totals.
ERR8972381
RV36_s
- Reads
- 3,517,266
- Distinct strings in file
- 3,451,341
- File size
- 20.8 MiB
Source attribution · SHA-256
- Source project:
- PRJEB51212
- Archive record:
- ERR8972381
- Sample:
- SAMEA13183964
- SHA-256
- 2295c4be8097c6777fd6f9a552d7fb3bed9715cfd9519d6d2a550b661caa6404
Exact read query
Queries are case-sensitive. No trimming or reverse-complement merging is applied.
| Sequence | Count | Read fraction |
|---|---|---|
| AAAAAAATTATTTGAACAAAG | 1 | 2.84312e-07 |
| AAAAAAATTATTTGTTGTAAG | 3 | 8.52935e-07 |
| AAAAAAATTATTTTGATTCTG | 1 | 2.84312e-07 |
| AAAAAAATTATTTTTCAATAG | 1 | 2.84312e-07 |
| AAAAAAATTCAAACTAATACA | 1 | 2.84312e-07 |
| AAAAAAATTCAAATTCAGCAG | 1 | 2.84312e-07 |
| AAAAAAATTCAACTATCGAAA | 1 | 2.84312e-07 |
| AAAAAAATTCAATTATCCTCG | 1 | 2.84312e-07 |
| AAAAAAATTCACAACTCTTAA | 1 | 2.84312e-07 |
| AAAAAAATTCATAAGCCGCAG | 1 | 2.84312e-07 |
| AAAAAAATTCATACTTCCTTA | 1 | 2.84312e-07 |
| AAAAAAATTCATGAAAAGCTT | 1 | 2.84312e-07 |
| AAAAAAATTCCAAGACGATTA | 1 | 2.84312e-07 |
| AAAAAAATTCCAATAAGTAAA | 1 | 2.84312e-07 |
| AAAAAAATTCCACCCCCGTTA | 1 | 2.84312e-07 |
| AAAAAAATTCCAGCTTTACAG | 1 | 2.84312e-07 |
| AAAAAAATTCCATCACAGTAG | 1 | 2.84312e-07 |
| AAAAAAATTCCCAGAACTCAA | 1 | 2.84312e-07 |
| AAAAAAATTCCGAACACTTCA | 1 | 2.84312e-07 |
| AAAAAAATTCCTAATCACAAA | 1 | 2.84312e-07 |
| AAAAAAATTCCTATCTATCCG | 1 | 2.84312e-07 |
| AAAAAAATTCCTCTCACGACC | 1 | 2.84312e-07 |
| AAAAAAATTCGAATAAGGATT | 1 | 2.84312e-07 |
| AAAAAAATTCGACTTTTCTTT | 1 | 2.84312e-07 |
| AAAAAAATTCGATGTAGATAA | 1 | 2.84312e-07 |
Read fractions use all reads in this source file as the denominator.