These collections primarily describe transcription-factor–DNA binding. They include source-reported controls and constructs; file totals are not target or validated aptamer totals.
ERR9130377
RV04_s
- Reads
- 323,585
- Distinct strings in file
- 323,414
- File size
- 2.1 MiB
Source attribution · SHA-256
- Source project:
- PRJEB51473
- Archive record:
- ERR9130377
- Sample:
- SAMEA13317613
- SHA-256
- 45ce88c9a16869d019c2eacca091f15e9899614753020017b12cdf4c560ede67
Exact read query
Queries are case-sensitive. No trimming or reverse-complement merging is applied.
| Sequence | Count | Read fraction |
|---|---|---|
| AAATATTAGTTGCACGCGCAA | 1 | 3.09038e-06 |
| AAATATTATCCAGCGCTTTAA | 1 | 3.09038e-06 |
| AAATATTATCTGACCTTACAA | 1 | 3.09038e-06 |
| AAATATTATTGCCTCCCTATA | 1 | 3.09038e-06 |
| AAATATTATTTCTGAGTACTA | 1 | 3.09038e-06 |
| AAATATTCAAATTGTAGAGCA | 1 | 3.09038e-06 |
| AAATATTCACATGTGGGGCTA | 1 | 3.09038e-06 |
| AAATATTCATTTTCGGGTGTA | 1 | 3.09038e-06 |
| AAATATTCCCCCTAAAAGACA | 1 | 3.09038e-06 |
| AAATATTCCCGTTGTGTTACA | 1 | 3.09038e-06 |
| AAATATTCCGTCAACTAAACA | 1 | 3.09038e-06 |
| AAATATTCGGTTCATCGTCTA | 1 | 3.09038e-06 |
| AAATATTCTCAGACGGCCTGA | 1 | 3.09038e-06 |
| AAATATTCTGAATTGTAGCTA | 1 | 3.09038e-06 |
| AAATATTCTGTTAGCTCGCTA | 1 | 3.09038e-06 |
| AAATATTGAGGTTAGTACTAA | 1 | 3.09038e-06 |
| AAATATTGCACCGAGTCGCGA | 1 | 3.09038e-06 |
| AAATATTGCATCGGCGCGAGA | 1 | 3.09038e-06 |
| AAATATTGGACAATCAACTGA | 1 | 3.09038e-06 |
| AAATATTGGATTGACTAGCAA | 1 | 3.09038e-06 |
| AAATATTGGGAAGCGAGGCCA | 1 | 3.09038e-06 |
| AAATATTGTACGCGTGCTTGA | 1 | 3.09038e-06 |
| AAATATTGTACGGATCCGTGA | 1 | 3.09038e-06 |
| AAATATTTAAACGTTAAGAGA | 1 | 3.09038e-06 |
| AAATATTTAAGTGGAAGTCGA | 1 | 3.09038e-06 |
Read fractions use all reads in this source file as the denominator.