These collections primarily describe transcription-factor–DNA binding. They include source-reported controls and constructs; file totals are not target or validated aptamer totals.
ERR9130404
RV31_s
- Reads
- 322,692
- Distinct strings in file
- 319,175
- File size
- 2.0 MiB
Source attribution · SHA-256
- Source project:
- PRJEB51473
- Archive record:
- ERR9130404
- Sample:
- SAMEA13317640
- SHA-256
- 471fae8f39eac096d75d84cc349e8eb967b6450fda8cefe7f19585b307cb72fe
Exact read query
Queries are case-sensitive. No trimming or reverse-complement merging is applied.
| Sequence | Count | Read fraction |
|---|---|---|
| AAACATCATATCGTGTTCTAA | 1 | 3.09893e-06 |
| AAACATCATGATAACTGTATA | 1 | 3.09893e-06 |
| AAACATCATGGTACGAACCTA | 1 | 3.09893e-06 |
| AAACATCCAAATTAAGCTAGA | 1 | 3.09893e-06 |
| AAACATCCAACATATCTATGA | 1 | 3.09893e-06 |
| AAACATCCAAGTTGGCCCTGA | 1 | 3.09893e-06 |
| AAACATCCAATCTTTCACTGA | 1 | 3.09893e-06 |
| AAACATCCAGGTACGTGCTCA | 1 | 3.09893e-06 |
| AAACATCCATTCTCAGTTGAA | 1 | 3.09893e-06 |
| AAACATCCCCGAATAGTTAGA | 1 | 3.09893e-06 |
| AAACATCCGAGATATCCAGTA | 1 | 3.09893e-06 |
| AAACATCCGATAAGTTAGCCA | 1 | 3.09893e-06 |
| AAACATCCGTGGATCTATAAA | 1 | 3.09893e-06 |
| AAACATCCGTTTAACAAACGA | 1 | 3.09893e-06 |
| AAACATCCTAACTCTGCTCGA | 1 | 3.09893e-06 |
| AAACATCCTACTGGTTCCCCA | 1 | 3.09893e-06 |
| AAACATCCTATCGCTCGGTAA | 1 | 3.09893e-06 |
| AAACATCCTTATCCACAGTCA | 1 | 3.09893e-06 |
| AAACATCGAAGTGTAACGCAA | 1 | 3.09893e-06 |
| AAACATCGCAAATTACCAAGA | 1 | 3.09893e-06 |
| AAACATCGGAAGCCACACCGA | 1 | 3.09893e-06 |
| AAACATCGTAAAACAAAGTGA | 1 | 3.09893e-06 |
| AAACATCGTTGAGGCTCACGA | 1 | 3.09893e-06 |
| AAACATCTATCTCCAGTTACA | 1 | 3.09893e-06 |
| AAACATCTGCATGTTAACCGA | 1 | 3.09893e-06 |
Read fractions use all reads in this source file as the denominator.